View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3080_high_12 (Length: 254)
Name: NF3080_high_12
Description: NF3080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3080_high_12 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 17 - 254
Target Start/End: Original strand, 5939980 - 5940217
Alignment:
| Q |
17 |
agaagcagtactagaaatggttatatttgatctttgagaccttgtatcttctctaaagcttctcatataagaacctgaataccttctagaattgttgtta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5939980 |
agaagcagtactagaaatggttatatttgatctttgagaccttgtatcttctctaaagcttctcatataagaacctgaataccttctagaattgttgtta |
5940079 |
T |
 |
| Q |
117 |
ctctctctagtgattcttgctttcactgaccattctctcaaattaaaatctgattcatctcttcttcttgaactatagggatatgattcagcattgtagg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5940080 |
ctctctctagtgattcttgctttcactgaccattctctcaaattaaaatctgattcatctcttcttcttgaactatagggatatgattcagcattgtagg |
5940179 |
T |
 |
| Q |
217 |
ccatgaatgagttatgaactcaaaagagtagaatcttt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5940180 |
ccatgaatgagttatgaactcaaaagagtagaatcttt |
5940217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 17 - 72
Target Start/End: Complemental strand, 6893503 - 6893448
Alignment:
| Q |
17 |
agaagcagtactagaaatggttatatttgatctttgagaccttgtatcttctctaa |
72 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||| ||| ||||||||||| |
|
|
| T |
6893503 |
agaagcagtgctagaaatggttatatttgatctaaaagactttgaatcttctctaa |
6893448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University