View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3080_high_9 (Length: 329)
Name: NF3080_high_9
Description: NF3080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3080_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 18 - 317
Target Start/End: Complemental strand, 6993619 - 6993320
Alignment:
| Q |
18 |
gaataatagtgagtgttgttatggtattgtttttgttagtagagttaacagtgagtttgagttcaagaactgaatggtcagcgttattggagcttcgttc |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6993619 |
gaataacagtgagtgttgttatggtattgtttttgttagtagagttaacagtgagtttgagttcaagaactgaatggtcagcgttattggagcttcgttc |
6993520 |
T |
 |
| Q |
118 |
atcgatggggataagggggaaggagtggcctnnnnnnnctgatccatgtcggaactggaccggtgttgagtgccggaacgatcaagttgttggtatcaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6993519 |
atcgatggggataagggggaaggagtggcctaaaaaaactgatccatgtcggaactggaccggtgttgagtgccggaacgatcaagttgttggtatcaaa |
6993420 |
T |
 |
| Q |
218 |
gtggctgggttgaatagaacccacaaaggtcgtcttaacccaagttttgaagttgatgctcttgcaaatttcacactattggagtctttcaatgcttctg |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6993419 |
gtggctgggttgaatagaacccacaaaggtcgtcttaacccgagttttgaagttgatgctcttgcaaatttcacactattggagtctttcaatgcttctg |
6993320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University