View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3082_low_4 (Length: 304)
Name: NF3082_low_4
Description: NF3082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3082_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 141 - 288
Target Start/End: Complemental strand, 43766790 - 43766643
Alignment:
| Q |
141 |
ttctgcgaacttgcttacgttgcctccaaatttttcgatatgaatnnnnnnngtttgtaattaagatctgaaaatgaaattactagtttgattaatgcaa |
240 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43766790 |
ttctgcgaacttgcatacgttgcctccaaatttttcgatatggataaaaaaagtttgtaattaagatctgaaaatgaaattactagtttgattaatgcaa |
43766691 |
T |
 |
| Q |
241 |
ccatgagattaagacctactgtactcnnnnnnngtcgacaaatcctaa |
288 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43766690 |
ccatgagattaagacctactgtactctttttctgtcgacaaatcctaa |
43766643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 23 - 107
Target Start/End: Complemental strand, 43766916 - 43766832
Alignment:
| Q |
23 |
agagaagagaagagcagagaaagtgtgtgagtgggacaagaagatttgataggatcttttacgaggcaaaaagcaactgggccac |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43766916 |
agagaagagaagagcagagaaagtgtgtgagtgggacaagaagatttgataggatcttttacgaggcaaaaagcaactgggccac |
43766832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 43766948 - 43766913
Alignment:
| Q |
1 |
agagggacacgaacctcgtttgagagaagagaagag |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
43766948 |
agagggacacgaacctcgtttgagagaagagaagag |
43766913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University