View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3082_low_7 (Length: 242)
Name: NF3082_low_7
Description: NF3082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3082_low_7 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 3530183 - 3529959
Alignment:
| Q |
18 |
ggataaatcctaggatttatcctagaattgaaacttaaatccttctcaatgtcaaaacttagaacatgtgaaagttggttagaagacactattaataatg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3530183 |
ggataaatcctaggatttatcctagaattgaaacttaaatccttctcaatgtcaaaacttaaaacatgtgaaagttggttagaagacactattaataatg |
3530084 |
T |
 |
| Q |
118 |
attcttcttcaagttgttgttgatgcttttgttgttgctcttcctcactagcttgtttcatagctgctctatgaaacttcaaggcagttacaatttcttt |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3530083 |
attcttcttcaacttgttgttgatgcttttgttgttgctcttcctcactagcttgtttcatagctgctctatgaaacttcaaggcagttacaatttcttt |
3529984 |
T |
 |
| Q |
218 |
tctagcctcagccatatttagaagt |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3529983 |
tctagcctcagccatatttagaagt |
3529959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University