View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3083_high_11 (Length: 409)
Name: NF3083_high_11
Description: NF3083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3083_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 9 - 388
Target Start/End: Original strand, 47374390 - 47374769
Alignment:
| Q |
9 |
agcagagaaagagagaaactaagaaacggcggagagaaggtgatggttgttctccataaacaaaaccaaaccctagttttgttttacattgttgggtcat |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47374390 |
agcaaagaaagagagaaactaagaaacggcggaaagaaggtgatggatgttctccataaacaaaatcaaaccctagttttgttttacattgttgggtcat |
47374489 |
T |
 |
| Q |
109 |
taatcatataagttggtttgaatatggttcaacccacaaacaattttatctaattaatcatataattattatatatatcagacgggttcggtttccgatg |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47374490 |
taatcatataagttagtttgaatatggttcaacccacaaacaattttatctaattaatcatataattattatatatatcagacgggttcggtttccgatg |
47374589 |
T |
 |
| Q |
209 |
gactcagaccacccacttggaaccgaccgtgcctaaccaatatattatggttttatgcaacccgcttgactcgaagccctgaataaacataactgcttgc |
308 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47374590 |
gactcagaccacccacctggaacccaccgtgcctaaccaatatattatggttttatgcaacccgcttgacccgaagccctgaataaacataactgcttgc |
47374689 |
T |
 |
| Q |
309 |
tttcgagtgttctgctccggactgtttgggccagttacaatttttctccagccctagcagctgcagagattcaataaaaa |
388 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47374690 |
tttcgagtgttctgctccggacggtttgggccagttacaatttttccccagccctagcagctgcagagattcaataaaaa |
47374769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University