View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3083_high_24 (Length: 311)

Name: NF3083_high_24
Description: NF3083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3083_high_24
NF3083_high_24
[»] chr5 (1 HSPs)
chr5 (21-281)||(9269217-9269465)


Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 21 - 281
Target Start/End: Original strand, 9269217 - 9269465
Alignment:
21 aatagagaggaaaaatgtgtttaattctcattgcatagaggagaaggagcaggacgatggtagacagatagagagaagagactgactttctggatagaaa 120  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||       
9269217 aatagagaggaaaaatgtgcttaattctcattgcatagaggagaaggagcaggacgatggtagacagatggagagaagagactgactttctggatag--- 9269313  T
121 cagaaaaggaagaaattaatcgtataatttattaaatgtaaaaaagggacaatcctttgacaattgtagaatagttaaaaatattagggtgaacttatga 220  Q
            ||||||||||||| ||||||||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||||| ||||||||||||    
9269314 --------gaagaaattaatcctataatttattaaatgtgaaaaagggaaaatcctttggcaattgtagaatagttaaaaatattagagtgaacttatga 9269405  T
221 tgtaaattaaataacctaagaggtgaaatctataaaggatgttaccggtaaaactgtctat 281  Q
    ||||||||||||||| ||| |||||||||||||||||||||||| |||||||||| |||||    
9269406 tgtaaattaaataacttaa-aggtgaaatctataaaggatgttatcggtaaaactttctat 9269465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University