View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3083_high_33 (Length: 270)
Name: NF3083_high_33
Description: NF3083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3083_high_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 20 - 249
Target Start/End: Original strand, 40064304 - 40064534
Alignment:
| Q |
20 |
ggcttaatttttgtgtcatgtcaaactcaaattttgacttggttgcaannnnnnnnn-attataacatttatggttgacccttctttgttgcaaattgtc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40064304 |
ggcttaatttttgtgtcatgtcaaactcaaattttgacttggttgcaattttttttttattataacatttatggttgacccttctttcttgcaaattgtc |
40064403 |
T |
 |
| Q |
119 |
tgagaaagactactctgattttgcataactttagtatttggatctatagatgtgtcattggatttgcaatcaaacatcgcagtctcctccaagatgtcaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40064404 |
tgagaaagactactctgattttgcataactttagtatttggatctatagatgtgtcactggatttgcaatcaaacattgcagtctcctccaagatgtcaa |
40064503 |
T |
 |
| Q |
219 |
gagcatactttctttgagcgatggcaatgtg |
249 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |
|
|
| T |
40064504 |
gagcatactttctttgagagatggcaatgtg |
40064534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University