View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3083_high_38 (Length: 258)
Name: NF3083_high_38
Description: NF3083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3083_high_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 7 - 239
Target Start/End: Complemental strand, 40897985 - 40897754
Alignment:
| Q |
7 |
aatggatttgatgcgagttataagaaaatgagattggctctattgagtgtaatgttggtggtgatacttgttgctgtcttaggttttctatttatagatg |
106 |
Q |
| |
|
||||||||||||| |||||| ||||||||| ||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40897985 |
aatggatttgatgtgagttacaagaaaatgggattggctctattgaatgtaatgttagtaatgatacttgttgctgtcttaggttttctatttatagatg |
40897886 |
T |
 |
| Q |
107 |
gtagagccataaggagagaaatgcatctgtgtgcctcactcatcaaacaaaaagaggccactcaccaagttgagaggaaaaaatatgaacaagagcctcg |
206 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
40897885 |
gtagagccataaggagagaaatgcatttgtgtgcctcacttatcaaacaaaaagaggccactcaccaagctgaga-gaaaaaatatgaacaagagcctcg |
40897787 |
T |
 |
| Q |
207 |
tcgttgctagcgccagccacgacgtttgcactt |
239 |
Q |
| |
|
|||||||||||| ||||| || ||| |||||| |
|
|
| T |
40897786 |
ccgttgctagcgctagccatgatgttcgcactt |
40897754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University