View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3083_high_46 (Length: 250)

Name: NF3083_high_46
Description: NF3083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3083_high_46
NF3083_high_46
[»] chr3 (1 HSPs)
chr3 (1-246)||(51627244-51627489)


Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 51627244 - 51627489
Alignment:
1 tgatttgactgatgatggaatggaatatagccagtttctctgtattgatttgcagccacgggaattatggaatacatcttttgaagatccatctctttta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51627244 tgatttgactgatgatggaatggaatatagccagtttctctgtattgatttgcagccacgggaattatggaatacatcttttgaagatccatctctttta 51627343  T
101 gaaaatatcgaaacaaaatggagtgccattttatcaaaaataaaggatatactgataaagaaagcttctgatgaaaatttggaaatagcaaacactttgc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51627344 gaaaatatcgaaacaaaatggagtgccattttatcaaaaataaaggatatactgataaagaaagcttctgatgaaaatttggaaatagcaaacactttgc 51627443  T
201 ttagagcttgctataatttttaccgggagagttcttctgtgttgct 246  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||    
51627444 ttagagcttgctataatttttaccgggagagttcttctgtggtgct 51627489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University