View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3083_high_49 (Length: 240)
Name: NF3083_high_49
Description: NF3083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3083_high_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 52 - 189
Target Start/End: Complemental strand, 37389886 - 37389749
Alignment:
| Q |
52 |
ccccactagatatgtatgaagaatatgaatctttatcttagacttgaatagataaaaaagtaatccgtttgtagtaaactggttataaaatttaccgtgt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37389886 |
ccccactagatatgtatgaagaatatgaatctttatcttagacttgaatagataaaaaagtaatccgtttgtagtaaactggttataaaatttaccgtgt |
37389787 |
T |
|
| Q |
152 |
taaatttcatacaacctaaacatttatatgcatgcgcg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37389786 |
taaatttcatacaacctaaacatttatatgcatgcgcg |
37389749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 51
Target Start/End: Complemental strand, 37389941 - 37389902
Alignment:
| Q |
12 |
cacagacaaaacaccaaaacagataatttcacttgaatac |
51 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
37389941 |
cacaaacaaaacaccaaaacagagaatttcacttgaatac |
37389902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 65 - 138
Target Start/End: Original strand, 44153505 - 44153579
Alignment:
| Q |
65 |
gtatgaagaatatgaatctttatcttaga-cttgaatagataaaaaagtaatccgtttgtagtaaactggttata |
138 |
Q |
| |
|
|||| ||| ||||||||| |||||||| | ||||| ||||||||||| ||||||| ||||||||| | ||||||| |
|
|
| T |
44153505 |
gtatcaagtatatgaatccttatcttaaaacttgattagataaaaaattaatccgcttgtagtaatcaggttata |
44153579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University