View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3083_high_50 (Length: 239)
Name: NF3083_high_50
Description: NF3083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3083_high_50 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 18575675 - 18575911
Alignment:
| Q |
18 |
ctagaatcaatcaatctcttgaaaatgcaaaataacattgtctacaatagcttcttcaataataa------------------cttgcccttcatctgcc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
18575675 |
ctagaatcaatcaatctcttgaaaatgcaaaataacattgtctacaatagcttcttcaaaaataattgcctaaaataaaccaacttgcccttcatctgcc |
18575774 |
T |
 |
| Q |
100 |
aatactttatccatgttaaggattcacatgtctgagttttgtctatgttgttaatacttgtataagataaaattcagaaaaattgaaattttaattctag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18575775 |
aatactttatccatgttaaggattcacatgtgtgagttttatctatgtt---aatacttgtataagataaaattcagaaaaattgaaattttaattctag |
18575871 |
T |
 |
| Q |
200 |
tgacataaactaacaaatttggaatttgcatgttatctat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18575872 |
tgacataaactaacaaatttggaatttgcatgttatctat |
18575911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University