View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3083_high_58 (Length: 234)
Name: NF3083_high_58
Description: NF3083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3083_high_58 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
| [»] scaffold0648 (1 HSPs) |
| | |
|
| [»] scaffold0274 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 234
Target Start/End: Complemental strand, 7238404 - 7238186
Alignment:
| Q |
16 |
ataactatgtaaaattgtggtctgaataccatagaattcaacatgcttttagctttctttgacgcttttcttttattctcattagattcaatatttgttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7238404 |
ataactatgtaaaattgtggtctgaataccatagaattcaacatgcttttagctttctttgacgcttttcttttattctcattagattcaatatttgttc |
7238305 |
T |
|
| Q |
116 |
gagtttatgaatcaatgatgaatgtcacgcgggctgtaactattggagcgcaagggagtgaagggacttcttaccatgacggtcttttcttttcgatctt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7238304 |
gagtttatgaatcaatgatgaatgtcacgcgggctgtaactattggagcacaagggagtgaagggacttcttaccatgacggtcttttcttttcgatctt |
7238205 |
T |
|
| Q |
216 |
tactttcttggtggcttcc |
234 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7238204 |
tactttcttggtggcttcc |
7238186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 208
Target Start/End: Original strand, 41442480 - 41442513
Alignment:
| Q |
175 |
gaagggacttcttaccatgacggtcttttctttt |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
41442480 |
gaagggactccttaccatgacggtcttttctttt |
41442513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 69 - 232
Target Start/End: Complemental strand, 5839417 - 5839262
Alignment:
| Q |
69 |
tttctttgacgcttttcttttattctcattagattcaatatttgttcgagtttatgaatcaatgatgaatgtcacgcgggctgtaactattggagcgcaa |
168 |
Q |
| |
|
|||||||||| |||| |||||| ||||| |||||||||||||||||||||||||||||||| ||| || ||| | ||||||||| ||||||||| |
|
|
| T |
5839417 |
tttctttgactctttctttttatcctcatcagattcaatatttgttcgagtttatgaatcaagaatggatctcatgagggctgtaattattggagc---- |
5839322 |
T |
|
| Q |
169 |
gggagtgaagggacttcttaccatgacggtcttttc-ttttcgatctttactttcttggtggctt |
232 |
Q |
| |
|
|| |||||| |||||||||||||||||||| |||||||||||||||| | ||||||||| |
|
|
| T |
5839321 |
-----agacgggactccttaccatgacggtcttttctttttcgatctttacttacctggtggctt |
5839262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0648 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0648
Description:
Target: scaffold0648; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 208
Target Start/End: Original strand, 5968 - 6001
Alignment:
| Q |
175 |
gaagggacttcttaccatgacggtcttttctttt |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
5968 |
gaagggactccttaccatgacggtcttttctttt |
6001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0274 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0274
Description:
Target: scaffold0274; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 208
Target Start/End: Complemental strand, 17490 - 17457
Alignment:
| Q |
175 |
gaagggacttcttaccatgacggtcttttctttt |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
17490 |
gaagggactccttaccatgacggtcttttctttt |
17457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University