View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3083_low_25 (Length: 311)
Name: NF3083_low_25
Description: NF3083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3083_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 21 - 281
Target Start/End: Original strand, 9269217 - 9269465
Alignment:
| Q |
21 |
aatagagaggaaaaatgtgtttaattctcattgcatagaggagaaggagcaggacgatggtagacagatagagagaagagactgactttctggatagaaa |
120 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9269217 |
aatagagaggaaaaatgtgcttaattctcattgcatagaggagaaggagcaggacgatggtagacagatggagagaagagactgactttctggatag--- |
9269313 |
T |
 |
| Q |
121 |
cagaaaaggaagaaattaatcgtataatttattaaatgtaaaaaagggacaatcctttgacaattgtagaatagttaaaaatattagggtgaacttatga |
220 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9269314 |
--------gaagaaattaatcctataatttattaaatgtgaaaaagggaaaatcctttggcaattgtagaatagttaaaaatattagagtgaacttatga |
9269405 |
T |
 |
| Q |
221 |
tgtaaattaaataacctaagaggtgaaatctataaaggatgttaccggtaaaactgtctat |
281 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
9269406 |
tgtaaattaaataacttaa-aggtgaaatctataaaggatgttatcggtaaaactttctat |
9269465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University