View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3083_low_26 (Length: 302)
Name: NF3083_low_26
Description: NF3083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3083_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 12 - 152
Target Start/End: Complemental strand, 41649633 - 41649493
Alignment:
| Q |
12 |
atgatatggataacataaaaatattaagaagaccaaatgtaagacttttatttgagtttgtcttgtatgagtcatttattttcaactgcttgatagtttc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41649633 |
atgatatggataacataaaaatattaagaagaccaaatgtaagacttttatttgagtttgtcttgtatgagtcatttattttcaactgcttgatagtttc |
41649534 |
T |
|
| Q |
112 |
tcacgaagaaattttatttagttgttcacacataatacaac |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41649533 |
tcacgaagaaattttatttagttgttcacacataatacaac |
41649493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University