View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3083_low_43 (Length: 252)
Name: NF3083_low_43
Description: NF3083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3083_low_43 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 252
Target Start/End: Original strand, 14103880 - 14104114
Alignment:
| Q |
18 |
attcaacatgttaggaatttacatgcaacgttcatggatcgttcttttcatcacaggaattctccttttacctcttttcatctttgcaacaccaatctta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14103880 |
attcaacatgttaggaatttacatgcaacgttcatggatcgttcttttcatcacaggaattctccttttacctcttttcatctttgcaacaccaatctta |
14103979 |
T |
|
| Q |
118 |
aacttttttggacaaccacaagagatatctgagctagctggagtgatttcaatgtggctaataccaactcacgtgacttatgcattcttttttcctcttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14103980 |
aacttttttggacaaccacaagagatatctgagctagctggagtgatttcaatgtggctaataccaactcacgtgacttatgcattcttttttcctcttt |
14104079 |
T |
|
| Q |
218 |
atttcttcttgcaaagtcagctcaagaataacatc |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
14104080 |
atttcttcttgcaaagtcagctcaagaataacatc |
14104114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University