View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3083_low_44 (Length: 251)
Name: NF3083_low_44
Description: NF3083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3083_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 3 - 233
Target Start/End: Complemental strand, 12610587 - 12610351
Alignment:
| Q |
3 |
atactttagaacaataccactatttgccatgttaaaacaacatata----tannnnnnnnaaaagttagcaatgtgtcgcgaattcaaggttttt-gatg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | ||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
12610587 |
atactttagaacaataccactatttgccatgttaaaacaacatattatttttttttttttaaagtttagcaatgtgtcgcgaattcaaggttttttgatg |
12610488 |
T |
 |
| Q |
98 |
tcttgatgacagcgatagaatcagaatacatgtttgcaatttttt-gcattatcaaggattgtgatgcaacctcgatttaaaaccttgtgatgacctatt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12610487 |
tcttgatgacagcgatagaatcagaatacatgtttgcaatttttttgcattatcaaggattgtgatgcaacctcgatttaaaaccttgtgatgacctatt |
12610388 |
T |
 |
| Q |
197 |
ggatgccatcaaaatatctcttttagctctctctttt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12610387 |
ggatgccatcaaaatatctcttttagctctctctttt |
12610351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University