View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3083_low_50 (Length: 246)
Name: NF3083_low_50
Description: NF3083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3083_low_50 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 13 - 233
Target Start/End: Original strand, 5376717 - 5376935
Alignment:
| Q |
13 |
cacagagcacagagcaatctctagacttatttattaagatcccgcccatgcaacaaaattttcaaatttctcnnnnnnnnnnnnnnnnnngaaagttgtc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
5376717 |
cacagagcacagagcaatctctagacttatttattaagatcccgcccatgcaactaaattttcaaatttctcaaaaaaaaaaaaaa-----aaagttgtc |
5376811 |
T |
|
| Q |
113 |
cttatatatttaagaattcattcactaaattacnnnnnnnnnnnnngttgattgtaatgataaatttgttagtaactttggtgtgagcagc---agataa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
5376812 |
cttatatatttaagaattcattcactaaattacaaaaatttaaaaagttgattgtaatgataaatttgttagtaactttggtgtgagcagcggacgatga |
5376911 |
T |
|
| Q |
210 |
gtgtttgaattttgtttttgatga |
233 |
Q |
| |
|
||||||||||||| ||||| |||| |
|
|
| T |
5376912 |
gtgtttgaattttattttttatga |
5376935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University