View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3083_low_53 (Length: 239)
Name: NF3083_low_53
Description: NF3083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3083_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 8 - 83
Target Start/End: Complemental strand, 48541691 - 48541616
Alignment:
| Q |
8 |
gggagaaatttattagagactaaattggatcttcgtcaatggtggttagggaaatttataatttacttaacttttt |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48541691 |
gggagaaatttattagagactaaattggatcttcgtgaatggtggttagggaaatttatactttacttaacttttt |
48541616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 157 - 232
Target Start/End: Complemental strand, 48541614 - 48541539
Alignment:
| Q |
157 |
cgaggggtggggatgagttttaccttctctatccccatacccaaccatatatacttacccgttatcagtggcgtag |
232 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||| |||||||||||||| || || ||||||||||||||| |
|
|
| T |
48541614 |
cgaggggtggggacgagttttaccttctctgtccccatatccaaccatatatacatatccattatcagtggcgtag |
48541539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 198
Target Start/End: Complemental strand, 10779065 - 10779027
Alignment:
| Q |
160 |
ggggtggggatgagttttaccttctctatccccataccc |
198 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
10779065 |
ggggtggggacgagttttaccttccctatccccataccc |
10779027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 138 - 198
Target Start/End: Complemental strand, 50427125 - 50427067
Alignment:
| Q |
138 |
attaggcatgataatgaagcgaggggtggggatgagttttaccttctctatccccataccc |
198 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
50427125 |
attaggcatggtaatgaggcg--gggtggggataggttttaccttctccatccccataccc |
50427067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 161 - 198
Target Start/End: Complemental strand, 32575206 - 32575169
Alignment:
| Q |
161 |
gggtggggatgagttttaccttctctatccccataccc |
198 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
32575206 |
gggtggggatgggttttaccttctctgtccccataccc |
32575169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University