View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3083_low_53 (Length: 239)

Name: NF3083_low_53
Description: NF3083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3083_low_53
NF3083_low_53
[»] chr1 (4 HSPs)
chr1 (8-83)||(48541616-48541691)
chr1 (157-232)||(48541539-48541614)
chr1 (160-198)||(10779027-10779065)
chr1 (138-198)||(50427067-50427125)
[»] chr5 (1 HSPs)
chr5 (161-198)||(32575169-32575206)


Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 8 - 83
Target Start/End: Complemental strand, 48541691 - 48541616
Alignment:
Q  8 gggagaaatttattagagactaaattggatcttcgtcaatggtggttagggaaatttataatttacttaacttttt 83  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||    
T  48541691 gggagaaatttattagagactaaattggatcttcgtgaatggtggttagggaaatttatactttacttaacttttt 48541616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 157 - 232
Target Start/End: Complemental strand, 48541614 - 48541539
Alignment:
Q  157 cgaggggtggggatgagttttaccttctctatccccatacccaaccatatatacttacccgttatcagtggcgtag 232  Q
    ||||||||||||| |||||||||||||||| |||||||| |||||||||||||| || || |||||||||||||||    
T  48541614 cgaggggtggggacgagttttaccttctctgtccccatatccaaccatatatacatatccattatcagtggcgtag 48541539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 198
Target Start/End: Complemental strand, 10779065 - 10779027
Alignment:
Q  160 ggggtggggatgagttttaccttctctatccccataccc 198  Q
    |||||||||| ||||||||||||| ||||||||||||||    
T  10779065 ggggtggggacgagttttaccttccctatccccataccc 10779027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 138 - 198
Target Start/End: Complemental strand, 50427125 - 50427067
Alignment:
Q  138 attaggcatgataatgaagcgaggggtggggatgagttttaccttctctatccccataccc 198  Q
    |||||||||| |||||| |||  ||||||||||  ||||||||||||| ||||||||||||    
T  50427125 attaggcatggtaatgaggcg--gggtggggataggttttaccttctccatccccataccc 50427067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 161 - 198
Target Start/End: Complemental strand, 32575206 - 32575169
Alignment:
Q  161 gggtggggatgagttttaccttctctatccccataccc 198  Q
    ||||||||||| |||||||||||||| |||||||||||    
T  32575206 gggtggggatgggttttaccttctctgtccccataccc 32575169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University