View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3083_low_54 (Length: 238)
Name: NF3083_low_54
Description: NF3083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3083_low_54 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 94 - 234
Target Start/End: Complemental strand, 24590072 - 24589932
Alignment:
| Q |
94 |
ggggctgttatagcaactcaaattggctgattaatagacgaaaaagattgagccatggaccaaagttaattaattcactaagctctcgaatgaaaagtta |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24590072 |
ggggctgttatagcaactcaaattggctgattaatagacgaaaaagattgagccatggaccaaagttaattaattcactaagctctcgaatgaaaagtta |
24589973 |
T |
 |
| Q |
194 |
gtaagggtgaatttgttgatatatggttcttattgatatga |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24589972 |
gtaagggtgaatttgttgatatatggttcttattgatatga |
24589932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 18 - 66
Target Start/End: Complemental strand, 24590148 - 24590100
Alignment:
| Q |
18 |
aaagtttataaacaatatcatgttacatattttggttgatgtgggacta |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24590148 |
aaagtttataaacaatatcatgttacatattttggttgatgtgggacta |
24590100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University