View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3084_high_17 (Length: 249)
Name: NF3084_high_17
Description: NF3084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3084_high_17 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 12 - 249
Target Start/End: Original strand, 44573160 - 44573397
Alignment:
| Q |
12 |
aaagggtaatgtggaagcccagtgaaagaagtataaaccatgttgagggttatgaattcgatcaatgacgaaatgggctacgttggaaacgatgatttgg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44573160 |
aaagggtaatgtggaagcccagtgaaagaagtataaaccatgttgagggttatgaattcgatcaatgacgaaatgggctacgttggaaacgatgatttgg |
44573259 |
T |
|
| Q |
112 |
gattcggcaaaacgggattggagagaatggtgagattgattggttttgaggatttgaattacgtcgtggattagggttttgatgtgtgggggaagagagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44573260 |
gattcggcaaaacgggattggagagaatggtgagattgattggttttgaggatttggattacgtcgtggattagggttttgatgtgtgggggaagagagg |
44573359 |
T |
|
| Q |
212 |
aagatgatgaaggttttgggtggtgatgaggtttgatg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44573360 |
aagatgatgaaggttttgggtggtgatgaggtttgatg |
44573397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University