View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3084_low_10 (Length: 414)
Name: NF3084_low_10
Description: NF3084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3084_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 388; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 388; E-Value: 0
Query Start/End: Original strand, 1 - 396
Target Start/End: Original strand, 30370851 - 30371246
Alignment:
| Q |
1 |
ggaggatcaattatttgtacttcaagtgcagctgcaactataggtggatttgcttcacatggctatacaatgtcaaaatcagctatggatggattaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30370851 |
ggaggatcaattatttgtacttcaagtgcagctgcaactataggtggatttgcttcacatggctatacaatgtcaaaatcagctatggatggattaatga |
30370950 |
T |
 |
| Q |
101 |
gaagtgcagcgtgcgaattaggtgttcatttgattcgcgttaattgtgtttctccgcacggcgttccttctaagatgcttttgaatgcttttagatgtta |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30370951 |
gaagtgcggcgtgcgaattaggtgttcatttgattcgcgttaattgtgtttctccgcacggcgttccttctgagatgcttttgaatgcttttagatgtta |
30371050 |
T |
 |
| Q |
201 |
tggtgaagttgatatgactagtgaacaattgagtgagtttattgggatgaatgcaagtttgcttaaagggagaggtgcaacaactgatgatgtcgcacag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30371051 |
tggtgaagttgatatgactagtgaacaattgagtgagtttattgggatgaatgcaagtttgcttaaagggagaggtgcaacaactgatgatgtcgcacag |
30371150 |
T |
 |
| Q |
301 |
gctgctctgtttttggctagtgatgaatctggatttgtaactgctcataatctttcagttgatggtggaatcacatctgctaatagtgttatgagt |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30371151 |
gctgctctgtttttggctagtgatgaatctggatttgtaactgctcataatctttcagttgatggtggaatcacatctgctaatagtgttatgagt |
30371246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University