View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3084_low_15 (Length: 310)
Name: NF3084_low_15
Description: NF3084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3084_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 4203161 - 4203378
Alignment:
| Q |
17 |
tagcaatttttccatgattctcttcttcattgatcactccnnnnnnnggaagattcactacttcaggacacatcctaaggttccaaaaattgttattgtt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4203161 |
tagcaatttttccatgattctcttcttcagtgatcactcctttttttggaagattcactacttcaggacacatcctaagattccaaaaattgttattgtt |
4203260 |
T |
 |
| Q |
117 |
actaggattttcttgaacttcattgttttgagattgttgttgtggcatgcaaggtgtagcagtgagaagtggaaaaatgccaaaaccaacacttaaggaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4203261 |
actaggattttcttgaacttcattgttttgagattgttgttgtggcatgcaaggtgtagcagtgagaagtggaaaaatgccaaaaccaacacttaatgaa |
4203360 |
T |
 |
| Q |
217 |
gctgatgaaggtaaagag |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4203361 |
gctgatgaaggtaaagag |
4203378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University