View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3084_low_17 (Length: 279)
Name: NF3084_low_17
Description: NF3084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3084_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 19 - 178
Target Start/End: Original strand, 5501429 - 5501588
Alignment:
| Q |
19 |
gtccaaaccctacaatgtttgacatctttctttgtctgaagcttttggaaatcccgaataataatttttccataacgaatgttggacctatatttcatca |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5501429 |
gtccaaaccctacaatgcttgacatctttctttgtctgaagcttttggaaatcccgaataataatttttccataacgaatgttggacctatatttcatca |
5501528 |
T |
|
| Q |
119 |
tggatgaagcctctgtgtaacttatctacggtaacgtctttgagaaatagttggttgtcc |
178 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5501529 |
tggatgaagcctctatgtaacttatctacggtaacgtctttgagaaatagttggttgtcc |
5501588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University