View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3084_low_22 (Length: 246)
Name: NF3084_low_22
Description: NF3084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3084_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 39370094 - 39370320
Alignment:
| Q |
1 |
ttatagttaagcattgttggcttatcnnnnnnn-ctttctttctaaattgacaaatttccatatgtagtgtgttgaagaagcttgcgaggtagcataaac |
99 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39370094 |
ttatagttaagcattgttggcttatctttcttttctttctttctcaattgacaaatttccat--gtagtgtgttgaagaagcttgcgaggtagcataaac |
39370191 |
T |
|
| Q |
100 |
ttgcatgaaggaaaagattgttgagtgttggcaattgcaacagatagatagatggatggatagatctagaggaaaaaagtacaacacttatgcttgaaga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
39370192 |
ttgcatgaaggaaaagattgttgagtgtaggcaattgcaacagatagata----gatagatagatctagaggaaaaaagtacaacacgtatgctggaaga |
39370287 |
T |
|
| Q |
200 |
aaatcgtacataagc--caacatgcaaccattt |
230 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |
|
|
| T |
39370288 |
aaatcgtacataagccacaacatgcaaccattt |
39370320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University