View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3086_high_10 (Length: 236)
Name: NF3086_high_10
Description: NF3086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3086_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 103 - 216
Target Start/End: Complemental strand, 17272332 - 17272225
Alignment:
| Q |
103 |
aatatatgtgcctgtctttggtacagataaagtcactagaatatgtctacatagtaattataacatgattttcttctagataaaacatgttctgagccaa |
202 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17272332 |
aatatatctgcctgtctttggtacagataaagtcactagaatatgtctacatagtaa------catgattttcttctagataaaacatgttctgagccaa |
17272239 |
T |
|
| Q |
203 |
acaaaataaagatt |
216 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
17272238 |
acaaaataaagatt |
17272225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 18 - 104
Target Start/End: Complemental strand, 17272657 - 17272574
Alignment:
| Q |
18 |
attagattgtttctatatagtattagttttatattggccaaaatagaatttcctcaaaattgggtaattatcaagaggatcttccaa |
104 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17272657 |
attagactgtttctatata---ttagttttatattggccaaaatagaatttcctcaaaattgggtaattatcaagaggatcttccaa |
17272574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University