View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3086_low_8 (Length: 246)
Name: NF3086_low_8
Description: NF3086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3086_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-128; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 3094225 - 3094455
Alignment:
| Q |
1 |
aaatttattgcctaaacacacaaatacttcaatgtctttggaacaattttgtagagacactgtgatgactatatggcattatcatggtggttgtcaagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3094225 |
aaatttattgcctaaacacacaaatacttcaatgtctttggaacaattttgtagagacactgtgatgactatatggcattatcatggtggttgtcaagtt |
3094324 |
T |
|
| Q |
101 |
ggtagggttgttgatagtgattataaggttgctggtgtccacgcattgcgcgtaatcgacggttctacctttaatcattctcctggaactaatcctcaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3094325 |
ggtagggttgttgatagtgattataaggttgctggtgtccacgcattgcgcgtaatcgacggttctacctttaatcattctcctggaactaatcctcaag |
3094424 |
T |
|
| Q |
201 |
ccactgttatgatgcttggaaggtaaaatat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3094425 |
ccactgttatgatgcttggaaggtaaaatat |
3094455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 3085379 - 3085609
Alignment:
| Q |
1 |
aaatttattgcctaaacacacaaatacttcaatgtctttggaacaattttgtagagacactgtgatgactatatggcattatcatggtggttgtcaagtt |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3085379 |
aaatttattgcctaagcacacaaatacttcaatgtctttggaacaattttgtagagacactgtgatgacaatatggcattatcatggtggttgtcaagtt |
3085478 |
T |
|
| Q |
101 |
ggtagggttgttgatagtgattataaggttgctggtgtccacgcattgcgcgtaatcgacggttctacctttaatcattctcctggaactaatcctcaag |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||| | ||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
3085479 |
ggtagggttgttgataatgattataaggttcttggtgtcgatgcattgcgcgtaatcgacggttctaccttcaactattctcctggaactaatcctcaag |
3085578 |
T |
|
| Q |
201 |
ccactgttatgatgcttggaaggtaaaatat |
231 |
Q |
| |
|
||||| | ||||||||||||||||||||||| |
|
|
| T |
3085579 |
ccactctcatgatgcttggaaggtaaaatat |
3085609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 41 - 90
Target Start/End: Complemental strand, 42960094 - 42960045
Alignment:
| Q |
41 |
gaacaattttgtagagacactgtgatgactatatggcattatcatggtgg |
90 |
Q |
| |
|
||||| |||||||||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
42960094 |
gaacagttttgtagagacactgtgatcactatttggcactatcatggtgg |
42960045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 112
Target Start/End: Original strand, 404890 - 404934
Alignment:
| Q |
68 |
actatatggcattatcatggtggttgtcaagttggtagggttgtt |
112 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
404890 |
actatatggcattatcatggtggatgtgttgttggtagggttgtt |
404934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University