View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3086_low_9 (Length: 245)
Name: NF3086_low_9
Description: NF3086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3086_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 51116708 - 51116495
Alignment:
| Q |
18 |
agcctaaaactctccctacggttatgccatattcacattcgcttttccatagtactagacccataaatgtttctcaaacagtttccaataacgttagctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51116708 |
agcctaaaactctccctacggttatgccatattcacattcgcttttccatagtactagacccataaatgtttctcaaacagtttccaataacgttagctt |
51116609 |
T |
 |
| Q |
118 |
ttattctgctctcgttcaggtaaaaatttacaaagttttagtaactgggacttatgaatgaat----gaatactttcaaagttgttgcctgtgcgccata |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51116608 |
ttattctgctctcgttcaggtaaaaatttacaaagttttagtaactgggacttatgaatgaatgaatgaatactttcaaagttgttgcctgtgcgccata |
51116509 |
T |
 |
| Q |
214 |
atattgttttttct |
227 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
51116508 |
atattgttttttct |
51116495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 20 - 92
Target Start/End: Complemental strand, 51109143 - 51109071
Alignment:
| Q |
20 |
cctaaaactctccctacggttatgccatattcacattcgcttttccatagtactagacccataaatgtttctc |
92 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51109143 |
cctaaaactctccctactgttatgccatattcgcattcgcttttccataatactagacccataaatgtttctc |
51109071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University