View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3088_low_12 (Length: 209)
Name: NF3088_low_12
Description: NF3088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3088_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 20 - 129
Target Start/End: Original strand, 44424430 - 44424539
Alignment:
| Q |
20 |
ttattatttattctttttactgattttattcattactaattaggttttgataggaactttctgttattacagaatggtagcataatgttttggtttggta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44424430 |
ttattatttattctttttactgattttattcattactaattaggttttgatagaaactttctgttattacagaatggtagcataatgttttggtttggta |
44424529 |
T |
 |
| Q |
120 |
tttcattcat |
129 |
Q |
| |
|
|||||||||| |
|
|
| T |
44424530 |
tttcattcat |
44424539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University