View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3090_high_38 (Length: 364)
Name: NF3090_high_38
Description: NF3090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3090_high_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 23 - 346
Target Start/End: Original strand, 55300640 - 55300963
Alignment:
| Q |
23 |
actcatgattttgttgtctttttaagtccagaagatcaatcactcatggcaacagaaccagaagcaactttggaggaggcgatggtgttgatccatcccg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55300640 |
actcatgattttgttgtctttttaagtccagaagatcaatcactcatggtaacagaaccagaagcaactttggaggaggcgatggtgttgatccatcccg |
55300739 |
T |
 |
| Q |
123 |
atatccaagggaagcctttgagggttaacaatccgtcatcatcacaagcaactttggagaagatggacgacggtagtgacgatgttgaaggcgggaagcc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55300740 |
atatccaagggaagcctttgagggttaacaatccgtcatcatcacaagcaactttggagaagatggacgacggtagtgacgatgttgaaggcgggaagcc |
55300839 |
T |
 |
| Q |
223 |
tttgagggttaattatgaatcagaaactattccagagaaaacaattttgtgtgacgatgttgtgttgttggttgaagagcataagagaaagcatttgagg |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
55300840 |
tttgagggttaattatgaatcagaaactattccagagaaaacaattttgtgtgacgatgttgtgttgttggttgaagagcataagagaaagcctttgagg |
55300939 |
T |
 |
| Q |
323 |
gagagagtaacatcaaattcggag |
346 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
55300940 |
gagagagtaacatcaaattcggag |
55300963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University