View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3090_high_58 (Length: 254)
Name: NF3090_high_58
Description: NF3090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3090_high_58 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 9 - 246
Target Start/End: Complemental strand, 7334722 - 7334485
Alignment:
| Q |
9 |
catcttgtgattgtttttcaaaagattgaaaggctaaaaggcggagagaaaatagtaaaatgtgagtcatttgaatccaacggctgagnnnnnnnnngtg |
108 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7334722 |
catcttgtgattgtttttcaaaaaattgaaaggctaaaagtcggagagaaaatagtaaaatgtgagtcatttgaatccaacggctgagagaaaaaaagtg |
7334623 |
T |
 |
| Q |
109 |
agaaaaatgcagatctatttttgatgcctcctgcaacgacaacctgattccctttcacaatcctcggtttgcaatatcaccgctctcaccatcttcacta |
208 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7334622 |
acaaaaatgcagatctatttttgatgcctcctgcaacgacaacccgattccctttcacaatcctcggtttgcaatatcaccgctctcaccatcttcacta |
7334523 |
T |
 |
| Q |
209 |
aacctttacacaacatcaccaccacttctctgctgctc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7334522 |
aacctttacacaacatcaccaccacttctctgctgctc |
7334485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University