View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3090_high_63 (Length: 239)
Name: NF3090_high_63
Description: NF3090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3090_high_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 5453131 - 5452911
Alignment:
| Q |
1 |
tgctaaaatggcggcaataggtgtggttataggggccattttgatttgagtagattgtattgtgttaagaagggtggttctaattatttttcggtagtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5453131 |
tgctaaaatggcggcaataggtgtggttataggggccattttgatttgagtagattgtattgtgttaagaaggctggttctaattatttttcggtagtga |
5453032 |
T |
 |
| Q |
101 |
tgatccaaatatctaaatgtatcaccatatatataaggagcttcatgaacaatgtaatggcacaatgggtgagttaattttactcaactact-cttaaca |
199 |
Q |
| |
|
||| ||||||| |||||||||||||||| |||||||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5453031 |
tgaaccaaatagctaaatgtatcaccatttatataaggagcatcaggaaca----aatggcacaatgggtgagttaattttactcaactactccttaaca |
5452936 |
T |
 |
| Q |
200 |
ttgggaaacaacaaacttaactttg |
224 |
Q |
| |
|
|||| |||||||||| |||||||| |
|
|
| T |
5452935 |
ttggaaaacaacaaatgtaactttg |
5452911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University