View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3090_high_66 (Length: 220)
Name: NF3090_high_66
Description: NF3090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3090_high_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 12 - 183
Target Start/End: Complemental strand, 8491924 - 8491752
Alignment:
| Q |
12 |
agcagagaaattggtaagattaatgtttccaacatctattgttcagttttcttattcaaattggtatgatttacannnnnnnnnnnnnnnnnaattaaca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8491924 |
agcagagaaattggtaagattaatgtttccaacatctattgttcagttttcttattcaaattggtatgatttacatttttatttttgtttctaattaaca |
8491825 |
T |
 |
| Q |
112 |
taaaattttgaaaaaattaacttcaacgttggttatgttgct-gggtttaattgtgcttttgtaaatctctct |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8491824 |
taaaattttgaaaaaattaacttcaacgttggttatgttgctggggtttaattgtgcttttgtaaatctctct |
8491752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University