View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3090_high_66 (Length: 220)

Name: NF3090_high_66
Description: NF3090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3090_high_66
NF3090_high_66
[»] chr4 (1 HSPs)
chr4 (12-183)||(8491752-8491924)


Alignment Details
Target: chr4 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 12 - 183
Target Start/End: Complemental strand, 8491924 - 8491752
Alignment:
12 agcagagaaattggtaagattaatgtttccaacatctattgttcagttttcttattcaaattggtatgatttacannnnnnnnnnnnnnnnnaattaaca 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                 ||||||||    
8491924 agcagagaaattggtaagattaatgtttccaacatctattgttcagttttcttattcaaattggtatgatttacatttttatttttgtttctaattaaca 8491825  T
112 taaaattttgaaaaaattaacttcaacgttggttatgttgct-gggtttaattgtgcttttgtaaatctctct 183  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
8491824 taaaattttgaaaaaattaacttcaacgttggttatgttgctggggtttaattgtgcttttgtaaatctctct 8491752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University