View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3090_low_75 (Length: 219)
Name: NF3090_low_75
Description: NF3090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3090_low_75 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 49 - 210
Target Start/End: Complemental strand, 22098737 - 22098576
Alignment:
| Q |
49 |
tggttgcaggtgtagggacttggatacgatcgaatagtaatttctttggaattttcacctctcttgcattgccttgttcttcaaggaccaacttttgatc |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22098737 |
tggttgcaggtgtagggacttggatacgatcaaatagtaatttctttggaattttcacctctcttgcattgccttgttcttcaagaaccaacttttgatc |
22098638 |
T |
|
| Q |
149 |
cattttctttaaggcttttagaaatnnnnnnntttcatccctttctccacattttcctttgc |
210 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22098637 |
cattttctttaaggctttgagaaatacaaatttttcatccctttctccacattttcctttgc |
22098576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University