View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3091_low_7 (Length: 250)
Name: NF3091_low_7
Description: NF3091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3091_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 422504 - 422604
Alignment:
| Q |
1 |
cctctagttttcacattaactttgaatacattgttgaacatgaatcaaacaaagaaaactcattgttcagtactaaagcaaaggaatttggagaagactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
422504 |
cctctagttttcacattaactttgaatacattgttgaacatgaatcaaacaaagaaaactcattgttcagtactaaagcaaaggaatttggagaagactc |
422603 |
T |
 |
| Q |
101 |
a |
101 |
Q |
| |
|
| |
|
|
| T |
422604 |
a |
422604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 155 - 239
Target Start/End: Original strand, 422613 - 422697
Alignment:
| Q |
155 |
ttcaacacaattgttagaatgacataaacaactcatctaatgtaacaatgacttgaattttttgttgctcttttttcagtttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
422613 |
ttcaacacaattgttagaatgacataaacaactcatctaatgtaacaatgacttgaattttttgttgctcttttttcagtttcat |
422697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University