View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3092_high_7 (Length: 295)
Name: NF3092_high_7
Description: NF3092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3092_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 278
Target Start/End: Complemental strand, 52996850 - 52996564
Alignment:
| Q |
1 |
taattttttattaacttctttattttt-gtgtgaaaccatctactatttattttccgtttcta--------caattacaatggatttatctttagatacg |
91 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52996850 |
taattttttattaacttcttttttttttgtgtgaaaccatctactatttattttccgtttctagtagtgtacaattacaatggatttatctttagatacg |
52996751 |
T |
 |
| Q |
92 |
ggttggactcatgaaagacaaagcttcaaatttgagtttccatgtgaatgtgttcggtgaagcaatcaaagaaagcaatattgattgtaatttagtttgg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52996750 |
ggttggactcatgaaagacaaagcttcaaatttgagtttccatgtgaatgtgttcagtgaagcaatcaaagaaagcaatattgattgtaatttagtttgg |
52996651 |
T |
 |
| Q |
192 |
gtttttatttattgaaataatgatgaaaataacatggaaaatgtggattcatatgtggattccattattcatgtgggatgatccact |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52996650 |
gtttttatttattgaaataatgatgaaaataacatggaaaatgtggattcatatgtggattccattattcatgtgggatgatccact |
52996564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University