View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3092_low_10 (Length: 253)
Name: NF3092_low_10
Description: NF3092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3092_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 14 - 235
Target Start/End: Complemental strand, 36998962 - 36998741
Alignment:
| Q |
14 |
cctgtgcaaaaagagatggcaacccataagaaagaggcaaagatgaaccaggcagagctagataagctggcagcacgtgaacacaatgcggcggtcaaac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36998962 |
cctgtgcaaaaagagatggcaacccataagaaagaggcaaagatgaaccaggcagagctagataagctggcagcacgtgaacacaatgcggcggtcaaac |
36998863 |
T |
|
| Q |
114 |
agacgaccactgctgcggctgggcatatgggtcagccccaccacaccacagggacgactggaacggggaccgccacatactctaccactgggaattatgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36998862 |
agacgaccactgctgcggctgggcatatgggtcagccccaccacaccacagggacgactggaacggggaccgccacatactctaccactgggaattatgg |
36998763 |
T |
|
| Q |
214 |
acatcccactggggcacatcag |
235 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36998762 |
acatcccactggggcacatcag |
36998741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 18 - 99
Target Start/End: Complemental strand, 36994151 - 36994070
Alignment:
| Q |
18 |
tgcaaaaagagatggcaacccataagaaagaggcaaagatgaaccaggcagagctagataagctggcagcacgtgaacacaa |
99 |
Q |
| |
|
|||||||||||||||||||||| |||||||| | || | | |||||||| ||||| ||||| ||| || ||||||||||| |
|
|
| T |
36994151 |
tgcaaaaagagatggcaacccaaaagaaagaagaaagggttaaccaggctgagcttgataaagaggcggcgcgtgaacacaa |
36994070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University