View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3092_low_13 (Length: 225)
Name: NF3092_low_13
Description: NF3092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3092_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 10 - 215
Target Start/End: Complemental strand, 52971999 - 52971794
Alignment:
| Q |
10 |
aatattggtaaaacacttgctccaacgtcactttgtattcacatgcatatttaagataattcatgacataacgagtcaatggatgaaccgctccatatgg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52971999 |
aatattggtaaaacacttgctccaacgtcactttgtattcacatgcatatttaagataattcatgacataacgagtcaatggatgaaccgctccatatgg |
52971900 |
T |
|
| Q |
110 |
gacgggaatcctttcattatcacccttgatggagttttccaaatcataaaacatcgaaacgacagcctttattattccatgctttgtcatagtcatctcg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52971899 |
gacgggaatcctttcattatcacccttgatggagttttccaaatcataaaacatcgaaacgacagcctttattattccatgctttgtcatagtcatctcg |
52971800 |
T |
|
| Q |
210 |
tatgcc |
215 |
Q |
| |
|
|||||| |
|
|
| T |
52971799 |
tatgcc |
52971794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University