View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3093_high_20 (Length: 245)

Name: NF3093_high_20
Description: NF3093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3093_high_20
NF3093_high_20
[»] chr1 (2 HSPs)
chr1 (1-181)||(42125333-42125516)
chr1 (193-229)||(42125306-42125342)


Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 42125516 - 42125333
Alignment:
1 ttttgattatgtgttgcttactttgatctttatcaattgctctcatagagcaactaattcaaacagataacaaagagcacattctgaccagaccaagcta 100  Q
    ||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42125516 ttttgattatgtgatgctcactttgatctttatcaattgctctcatagagcaactaattcaaacagataacaaagagcacattctgaccagaccaagcta 42125417  T
101 gaaaggcttcacggcattgctttcatgaacacgtac---cccaagaaattatggatgataattagaatgggtagcattgaatgt 181  Q
    ||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||    
42125416 gaaaggcttcacggcattgctttcatgaacacgtacgtacccaagaaattatggatgataattagaatgggtagcattgaatgt 42125333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 193 - 229
Target Start/End: Complemental strand, 42125342 - 42125306
Alignment:
193 cattgaatgtcagcatgaatatgaattttgtgcatta 229  Q
    |||||||||||||||||||||||||||||||||||||    
42125342 cattgaatgtcagcatgaatatgaattttgtgcatta 42125306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University