View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3093_high_20 (Length: 245)
Name: NF3093_high_20
Description: NF3093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3093_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 42125516 - 42125333
Alignment:
| Q |
1 |
ttttgattatgtgttgcttactttgatctttatcaattgctctcatagagcaactaattcaaacagataacaaagagcacattctgaccagaccaagcta |
100 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42125516 |
ttttgattatgtgatgctcactttgatctttatcaattgctctcatagagcaactaattcaaacagataacaaagagcacattctgaccagaccaagcta |
42125417 |
T |
 |
| Q |
101 |
gaaaggcttcacggcattgctttcatgaacacgtac---cccaagaaattatggatgataattagaatgggtagcattgaatgt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42125416 |
gaaaggcttcacggcattgctttcatgaacacgtacgtacccaagaaattatggatgataattagaatgggtagcattgaatgt |
42125333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 193 - 229
Target Start/End: Complemental strand, 42125342 - 42125306
Alignment:
| Q |
193 |
cattgaatgtcagcatgaatatgaattttgtgcatta |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42125342 |
cattgaatgtcagcatgaatatgaattttgtgcatta |
42125306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University