View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3093_high_23 (Length: 238)

Name: NF3093_high_23
Description: NF3093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3093_high_23
NF3093_high_23
[»] chr2 (1 HSPs)
chr2 (79-238)||(34641796-34641955)


Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 79 - 238
Target Start/End: Complemental strand, 34641955 - 34641796
Alignment:
79 aacttcgatttcatggtctagttgtcgtcgtggaccttttataagtgatatgttgaacttctttaatttccataaaatctctcaaaacttaaactctcaa 178  Q
    ||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34641955 aacttcgatttcatggtctagttgtagtcatggaccttttataagtgatatgttgaacttctttaatttccataaaatctctcaaaacttaaactctcaa 34641856  T
179 tagaagtttatgattggaagaggatggagatcaagattatagacatgatgttgcatatat 238  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34641855 tagaagtttatgattggaagaggatggagatcaagattatagacatgatgttgcatatat 34641796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University