View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3093_high_23 (Length: 238)
Name: NF3093_high_23
Description: NF3093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3093_high_23 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 79 - 238
Target Start/End: Complemental strand, 34641955 - 34641796
Alignment:
| Q |
79 |
aacttcgatttcatggtctagttgtcgtcgtggaccttttataagtgatatgttgaacttctttaatttccataaaatctctcaaaacttaaactctcaa |
178 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34641955 |
aacttcgatttcatggtctagttgtagtcatggaccttttataagtgatatgttgaacttctttaatttccataaaatctctcaaaacttaaactctcaa |
34641856 |
T |
 |
| Q |
179 |
tagaagtttatgattggaagaggatggagatcaagattatagacatgatgttgcatatat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34641855 |
tagaagtttatgattggaagaggatggagatcaagattatagacatgatgttgcatatat |
34641796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University