View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3093_high_24 (Length: 237)
Name: NF3093_high_24
Description: NF3093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3093_high_24 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 5 - 237
Target Start/End: Complemental strand, 42453784 - 42453552
Alignment:
| Q |
5 |
caaactcacccatctgtgttacaactcttccagctgaaactcttaatcgatcatatctatgcatcaaaatgatgtcttcgaatttggatggcattggatc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42453784 |
caaactcacccatctgtgttacaactcttccagctgaaactcttaatcgatcatatctatgcatcaaaatgatgtcttcgaatttggatggcattggatc |
42453685 |
T |
|
| Q |
105 |
aaactcttcttgcaattcatcttcacttgctgtatgcacatgagacaaatgcaaatctgcatgggataatgtttttggctttatttgaaattccagcagc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42453684 |
aaactcttcttgcaattcatcttcacttgctgtatgcacatgagacaaatgcaaatctgcatgggataatgtttttggctttatttgaaattcctgcagc |
42453585 |
T |
|
| Q |
205 |
atatggactataagagcaagaaatattgctggc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42453584 |
atatggactataagagcaagaaatattgctggc |
42453552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University