View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3093_high_28 (Length: 226)
Name: NF3093_high_28
Description: NF3093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3093_high_28 |
 | |
|
| [»] scaffold0064 (2 HSPs) |
| |
|
| [»] scaffold0116 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0064 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: scaffold0064
Description:
Target: scaffold0064; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 7 - 226
Target Start/End: Complemental strand, 21801 - 21582
Alignment:
| Q |
7 |
ccatcaacgacgtttcctggcttctacatatctcccgctccgatgaaaatcatgacagtgagaatctcatccttccttccatagctttcaacgagcccat |
106 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21801 |
ccatcaacgatgtttcctggcttctacatatctcccgctccgatgaaaatcatgacagtgagaatctcatccttccttccatagctttcaacgagcccat |
21702 |
T |
|
| Q |
107 |
cctcgccttaatttgggaactgattgctagcctttgtattggctcacaggaggatcgttcgaatgctgctgcttgtcttgtatcacttgcacatcaaagt |
206 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21701 |
cctcgcctcaatttgggaactgattgctagcctttgtactggctcacaggaggatcgttcggacgctgctgcttgtcttgtatcacttgcacatcaaagt |
21602 |
T |
|
| Q |
207 |
gatcgttacggtaaaatgat |
226 |
Q |
| |
|
|| |||||| |||||||||| |
|
|
| T |
21601 |
gaccgttacagtaaaatgat |
21582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0064; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 34 - 199
Target Start/End: Complemental strand, 4563 - 4398
Alignment:
| Q |
34 |
atatctcccgctccgatgaaaatcatgacagtgagaatctcatccttccttccatagctttcaacgagcccatcctcgccttaatttgggaactgattgc |
133 |
Q |
| |
|
|||||||||||| | ||||| ||||||| ||||| |||| |||||||||||||||| ||| || || ||||| | |||||||||||||||| ||||| |
|
|
| T |
4563 |
atatctcccgctgcaatgaagatcatgatagtgaaaatcacatccttccttccataattttaaatgaccccatggttaccttaatttgggaacttattgc |
4464 |
T |
|
| Q |
134 |
tagcctttgtattggctcacaggaggatcgttcgaatgctgctgcttgtcttgtatcacttgcaca |
199 |
Q |
| |
|
||||| |||| |||||||||||| ||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
4463 |
cagcctatgtaccggctcacaggagtatcgttcagacagtgctgcttctcttgtatcacttgcaca |
4398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0116 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: scaffold0116
Description:
Target: scaffold0116; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 23 - 224
Target Start/End: Complemental strand, 10774 - 10573
Alignment:
| Q |
23 |
ctggcttctacatatctcccgctccgatgaaaatcatgacagtgagaatctcatccttccttccatagctttcaacgagcccatcctcgccttaatttgg |
122 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | ||||| ||| ||| | ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10774 |
ctggctcctacatatctcccgctccgatgaaaagcttgacaatgaaaattttatccttccttccatagctttcaatgagcccatcctcgccttaatttgg |
10675 |
T |
|
| Q |
123 |
gaactgattgctagcctttgtattggctcacaggaggatcgttcgaatgctgctgcttgtcttgtatcacttgcacatcaaagtgatcgttacggtaaaa |
222 |
Q |
| |
|
|| ||||||||||||||||||| | ||||||| |||||||||||| ||||||||||||||||||| |||||||||| ||||||||| |||||||| |||| |
|
|
| T |
10674 |
gagctgattgctagcctttgtactagctcacaagaggatcgttcggatgctgctgcttgtcttgtgtcacttgcacttcaaagtgagcgttacggaaaaa |
10575 |
T |
|
| Q |
223 |
tg |
224 |
Q |
| |
|
|| |
|
|
| T |
10574 |
tg |
10573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University