View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3093_high_4 (Length: 499)
Name: NF3093_high_4
Description: NF3093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3093_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 443; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 443; E-Value: 0
Query Start/End: Original strand, 16 - 490
Target Start/End: Complemental strand, 34677647 - 34677173
Alignment:
| Q |
16 |
atgagttcttgcagttttaattcctctatttgttgatcatacagtgcatgaaattgtgtgaaatgaaataaagaagaggaagaattcaagaatttaagaa |
115 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34677647 |
atgagttcttgcagttttgattcctctatttgttgatcatacagtgcatgaaattgtgtgaaatgaaataaagaagaggaagaattcaagaatttaagaa |
34677548 |
T |
|
| Q |
116 |
cctgtttcttcatttggttttatattatattgtcctgtcttatattgtgtatgtctattttggattggaacaataaaatgcagctgcatatatctccaag |
215 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34677547 |
cctgttttttcatttggttttatattatattgtcctgtcttatattgtgtatgtctattttggattggaacaataaaatgcagctgcatatatctccaag |
34677448 |
T |
|
| Q |
216 |
tttgaggcatgttactgtccttcctggcaaaggacttaaagagtttatcaaagtgaaagttgcgtcgaggcgcctttcttataggatgctcttctattca |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34677447 |
tttgaggcatgttactgtccttcctggcaaaggacttaaagagtttatcaaagtgaaagttgcatcgaggcgcctttcttataggatgctcttctattca |
34677348 |
T |
|
| Q |
316 |
ctcttgttcttcacttttcttctgaggtttgtgtttgttttaacagctgtggatggcattgatggacaaaacaagtgctctaccataggtactctccccc |
415 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34677347 |
ctcttgttcttcacttttcttctgaggtttgtgtttgttctaacagctgtggatggcattgatggacaaaacaagtgctcttccataggtactctccccc |
34677248 |
T |
|
| Q |
416 |
ttctctctcacacatacgcacgcgtgcacacacacatagtcaggtcacctttagtcacaatatctcgctttcatc |
490 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34677247 |
ttctctttcacacacacgcacgcgtgcacacacacatagtcaggtcgcctttagtcacaatatctcgctttcatc |
34677173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University