View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3093_low_12 (Length: 284)
Name: NF3093_low_12
Description: NF3093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3093_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 16 - 135
Target Start/End: Complemental strand, 7194106 - 7193987
Alignment:
| Q |
16 |
attgtgagatctatatcagttcctatttccaagtcaatctcccaaccatacagggtccattatgttagagactaaaacnnnnnnnncacctcattcttgt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7194106 |
attgtgagatctatatcagttcctatttccaagtcaatctcccaaccataccgggtccattatgttagagactaaaacaaaaaaaacacctcattcttgt |
7194007 |
T |
 |
| Q |
116 |
ctactctttctctttcattg |
135 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
7194006 |
ctactctttctctttcattg |
7193987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University