View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3093_low_26 (Length: 227)
Name: NF3093_low_26
Description: NF3093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3093_low_26 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 42125862 - 42125633
Alignment:
| Q |
1 |
aggtgttaacacctttcatactcataatcgtctctcgaactaaaaaa-catagtaatttctggaattatcccaaattcaggttcttgaaatattttaatt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42125862 |
aggtgttaacacctttcatactcataatcgtctctcgacctaaaaaaacatagtaatttctggaattatcccaaattcaggttcttgaaatattttaatt |
42125763 |
T |
 |
| Q |
100 |
tgatttcaaattaatttttatcatcgtt--nnnnnnnntcacctttgaatattttcttggatagaaactggattggatatttattactcgtttattatta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42125762 |
tgatttcaaattaatttttatcatcgttaaaaaaaaaatcacctttgaatattttcttggatagaaactggattggatatttattactcgtttattatta |
42125663 |
T |
 |
| Q |
198 |
tcatcaattatttcgttgaaatcatgtata |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42125662 |
tcatcaattatttcgttgaaatcatgtata |
42125633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University