View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3093_low_30 (Length: 210)
Name: NF3093_low_30
Description: NF3093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3093_low_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 21 - 201
Target Start/End: Original strand, 33399596 - 33399776
Alignment:
| Q |
21 |
agggtgagggggaggctgaaggtgaggagggtgctggataccaaccatcttgttttggcaaaacatttatgaaaagcttttgtccattttcgcagtgatt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399596 |
agggtgagggggaggctgaaggtgaggagggtgctggataccaaccatcttgttttggtaaaacatttatgaaaagcttttgtccattttcgcagtgatt |
33399695 |
T |
|
| Q |
121 |
ggcaacacctgaaatgtaccatcttctcccaaaggttgtcaatgcaattttatcatgtccacttgttaacacaggttctgc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
33399696 |
ggcaacacctgaaatgtaccatcttctcccataggttgtcaatgcaattttatcatgtccacttgttaacactggtgctgc |
33399776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 54 - 196
Target Start/End: Original strand, 33441945 - 33442087
Alignment:
| Q |
54 |
ctggataccaaccatcttgttttggcaaaacatttatgaaaagcttttgtccattttcgcagtgattggcaacacctgaaatgtaccatcttctcccaaa |
153 |
Q |
| |
|
||||| |||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||| | |
|
|
| T |
33441945 |
ctggagaccaaccatcttgttttggctgcacagttatgaaaagcttttgtccattttcgcagtgatcggtaacacttgaaatgtaccatcttctcccata |
33442044 |
T |
|
| Q |
154 |
ggttgtcaatgcaattttatcatgtccacttgttaacacaggt |
196 |
Q |
| |
|
|||||| | | |||||| || || ||||| |||||||||||| |
|
|
| T |
33442045 |
ggttgtaattataattttgtcttgcccactggttaacacaggt |
33442087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 54 - 196
Target Start/End: Original strand, 33452165 - 33452307
Alignment:
| Q |
54 |
ctggataccaaccatcttgttttggcaaaacatttatgaaaagcttttgtccattttcgcagtgattggcaacacctgaaatgtaccatcttctcccaaa |
153 |
Q |
| |
|
||||| |||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||| | |
|
|
| T |
33452165 |
ctggagaccaaccatcttgttttggctgcacagttatgaaaagcttttgtccattttcgcagtgatcggtaacacttgaaatgtaccatcttctcccata |
33452264 |
T |
|
| Q |
154 |
ggttgtcaatgcaattttatcatgtccacttgttaacacaggt |
196 |
Q |
| |
|
|||||| | | |||||| || || ||||| |||||||||||| |
|
|
| T |
33452265 |
ggttgtaattataattttgtcttgcccactggttaacacaggt |
33452307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 21 - 192
Target Start/End: Original strand, 33395712 - 33395880
Alignment:
| Q |
21 |
agggtgagggggaggctgaaggtgaggagggtgctggataccaaccatcttgttttggcaaaacatttatgaaaagcttttgtccattttcgcagtgatt |
120 |
Q |
| |
|
||||||| ||||||||||||||||||| || ||||| |||||||| ||| |||| || ||||||||||||||||| ||| | |||||||| |
|
|
| T |
33395712 |
agggtgacggggaggctgaaggtgagg---gtactggagaccaaccaaactgtggtggctgcacgtttatgaaaagcttttggccaagattgcagtgatg |
33395808 |
T |
|
| Q |
121 |
ggcaacacctgaaatgtaccatcttctcccaaaggttgtcaatgcaattttatcatgtccacttgttaacac |
192 |
Q |
| |
|
||| |||||||||||||||||||||| ||| ||||||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
33395809 |
agcagcacctgaaatgtaccatcttcttccataggttgtcaataaaattgtatcatgtccactagttaacac |
33395880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University