View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3095_high_15 (Length: 304)
Name: NF3095_high_15
Description: NF3095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3095_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 21 - 299
Target Start/End: Original strand, 4411790 - 4412068
Alignment:
| Q |
21 |
cgcactttgctgtcaaaacggtttctcaactatataaggacttgagagagaggattagcaaacatattctttccatgggatcaaattttaacagttcatg |
120 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4411790 |
cgcactttgctgtcaaaacggtttctcgactatataaggacttgagagagaggattagcaaacatattctttccatgggatcaaattttaacagttcatg |
4411889 |
T |
 |
| Q |
121 |
gtcagaagaggataaggaattatctgttgaaacttcattcattcaaaagcaatgggctcttcaacagttgaaaaggaaagatcagttatggaggccccaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4411890 |
gtcagaagaggataaggaattatctgttgaaacttcattcattcaaaagcaatgggctcttcaacagttgaaaaggaaagatcagttatggaggccccaa |
4411989 |
T |
 |
| Q |
221 |
aggggcttgccagaaagatctgtttccgttctacgtgattggatgtttcagaatttcctccatccgtaagtattatcta |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4411990 |
aggggcttgccagaaagatctgtttccgttctacgtgattggatgtttcagaatttcctccatccgtaagtattatcta |
4412068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University