View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3095_low_24 (Length: 236)
Name: NF3095_low_24
Description: NF3095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3095_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 40 - 118
Target Start/End: Original strand, 28573272 - 28573350
Alignment:
| Q |
40 |
caagagaaccaacggatgtcttttgattgtttcccactaagccccatcaaaaggaattcatcatcttcttaaattattc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28573272 |
caagagaaccaacggatgtcttttgattgtttcccaataagccccatcaaaaggaattcatcatcttcttaaattattc |
28573350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 222
Target Start/End: Original strand, 28573343 - 28573375
Alignment:
| Q |
190 |
aattactctgcttgcttgagatagacacttact |
222 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
28573343 |
aattattctgcttgcttgagatagacacttact |
28573375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University