View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3096R-Insertion-4 (Length: 310)
Name: NF3096R-Insertion-4
Description: NF3096R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3096R-Insertion-4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 8 - 310
Target Start/End: Original strand, 28014368 - 28014670
Alignment:
| Q |
8 |
aactaaagttattgattcatctgccaatacatgtccgtgtataaaattgcttgcattcgcatttttaaaattacatttgaatgtgcaagaaaataacatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28014368 |
aactaaagttattgattcatctgccaatacatgtccgtgtataaaattgcttgcattcgcattttttaaattacatttgaatgtgcaagaaaataacatc |
28014467 |
T |
|
| Q |
108 |
aagaaagaacgtaaagttgttgacttattgtttcacaactggaggatttaatttcaaaattacacatactaaccaatattcatttgcattttaactaaaa |
207 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
28014468 |
aagaaagaccgtaaagctgttgacttattgtttcacaactgaaggatttaatttcaaaattacacatactaaccaatattcatttgcattttaactgaaa |
28014567 |
T |
|
| Q |
208 |
gtttgcaaaccccgattcaaaagaatctcactctcatctaaggattcactcaccnnnnnnnccttctaatttcctagtataagctctcatctccacattt |
307 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28014568 |
gtttgcacaccccgattcaaaagaatctcactctcatctaaggattcactcacctttttttccttctaatttcctagtataagctctcatctccacattt |
28014667 |
T |
|
| Q |
308 |
tgg |
310 |
Q |
| |
|
||| |
|
|
| T |
28014668 |
tgg |
28014670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University