View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3096R-Insertion-5 (Length: 346)
Name: NF3096R-Insertion-5
Description: NF3096R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3096R-Insertion-5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 8 - 240
Target Start/End: Original strand, 47818604 - 47818852
Alignment:
| Q |
8 |
atgtttaaaattttgagaatttacgaagaagaagtgtt-ggttggagtgggaaattgcagttcttttttgtgaagaagatagatagatagaagaagaagt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47818604 |
atgtttaaaattttgagaatttacgaagaagaagtgtttggttggagtgggaaattgcagttcttttttgtgaagaagatagatagatagaagaagaagt |
47818703 |
T |
|
| Q |
107 |
taaacctaaactcattg---------------aattgaatggctttgacaatctcaaacatacttcattgccctaaattcaacaacaacaataattcatc |
191 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47818704 |
taaacctaaactcattgaattgaattgaattgaattgaatggctttgacaatctcaaacatacttcattgccctaaattcaacaacaacaataattcatc |
47818803 |
T |
|
| Q |
192 |
caaccatttccgttcccaattttcaacctctctcaggtaacactcactc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47818804 |
caaccatttccgttcccaattttcaacctctctcaggtaacactcactc |
47818852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 274 - 346
Target Start/End: Original strand, 47818883 - 47818955
Alignment:
| Q |
274 |
cactgctttcttactgggttttattcaattttcaggtttcccaagaaaacatcatggattaacccaataatta |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47818883 |
cactgctttcttactgggttttattcaattttcaggtttcccaagaaaacatcatggattaacccaataatta |
47818955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University