View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3096_low_10 (Length: 282)
Name: NF3096_low_10
Description: NF3096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3096_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 19 - 265
Target Start/End: Complemental strand, 40895571 - 40895326
Alignment:
| Q |
19 |
acttggaatattaacttttgcttgtattgtaccgtatccccagatctatgaaaataaaagtttatcactttttctttaagggtttgactttccattttat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40895571 |
acttggaatattaacttttgcttgtattgtaccgtatccccagatctatgaaaataaaagtttatcactttttctttaagggtttgactttccattttat |
40895472 |
T |
|
| Q |
119 |
ttttagttagaggattaagatactgcaatgattaatataaacatatataggggtcatactactgacctacaaactagaactagaaagaagtttgtgctga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40895471 |
ttttagttagaggattaagatactgcaatgattaatataaacatatataggggtcatactactgacctacaaactagaactagaaagaagtttgtgctga |
40895372 |
T |
|
| Q |
219 |
agctttaggatcggcactgaacatcaagtaggtgatattgtagcatg |
265 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40895371 |
agc-ttaggatcggcactgaacatcaagtaggtgatattgtagcatg |
40895326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University